Introduction
Psoriasis is a chronic, immune-mediated systemic inflammatory disease that primarily manifests as skin lesions, affecting approximately 2–3% of the global population [1, 2]. Clinically, it is characterized by well-demarcated erythematous plaques covered with silvery-white scales, often accompanied by discomfort such as itching or pain. Furthermore, some patients develop comorbid conditions, most notably psoriatic arthritis, which collectively impose a profound detrimental impact on both physical health and psychological well-being [2–4].
The pathogenesis of psoriasis is remarkably complex, involving interplay between genetic predisposition and immune dysregulation, modulated by environmental triggers, psychosocial stress, metabolic disturbances, and microbial dysbiosis [3, 4]. Current therapeutic strategies are stratified according to disease extent, anatomical involvement, and comorbidity profile, encompassing topical agents, phototherapy, oral systemic drugs, biologic therapies, and targeted small-molecule drugs. While conventional approaches are safe, their efficacy is often suboptimal.
Novel systemic agents achieve rapid anti-inflammatory effects but carry drawbacks including generalized immunosuppression, heightened infection risk, and exorbitant treatment costs [2]. This therapeutic dilemma underscores the urgent need for safe, effective, and economically viable complementary treatments.
Magnetic field therapy represents a rapidly evolving non-pharmacological intervention in physical medicine, distinguished by its non-invasive nature and low adverse event profile. Two principal modalities are currently employed in clinical practice: static (or permanent) magnetic fields, which maintain constant field strength, and electromagnetic fields, which are generated only during active current flow. Research shows static magnetic fields modulate cellular functionality and regulate proliferation [5].
Dynamic Permanent Magnetic Field (DPMF) constitutes an innovative advancement in this domain, achieved through precise engineering of permanent magnet configurations to generate periodically varying local magnetic order at target sites, thereby inducing time-dependent oscillating potential energy and exerting targeted biophysical intervention [6].
The therapeutic efficacy of magnetic field therapy operates through multiple convergent pathways, including anti-inflammatory actions, immunomodulation, microcirculatory enhancement, antioxidant capacity, and regulation of mitochondrial superoxide anion generation. These mechanisms have demonstrated beneficial therapeutic roles across diverse pathological conditions, including oncology, anti-aging interventions, autoimmune diseases, orthopedic rehabilitation, diabetes mellitus, and diabetic complications [7–11]. Notably, Zhan et al. used Rotating Magnetic Field (RMF) in an experimental autoimmune encephalomyelitis murine model, demonstrating RMF significantly downregulated critical chemokines (CCL-2/3/5, CXCL-1/2/9/10), blocked CD4⁺ T-cell migration to the spinal cord, promoted regulatory T-cell differentiation, suppressed Th1/Th17 generation, and reduced IFN-γ and IL-17 levels [10].
In psoriasis, dendritic cells and Th17 cells, with their cytokines IL-17, IFN-γ, TNF-α, and IL-23, play pivotal roles in disease pathogenesis [3]. Given that permanent magnetic fields rebalance Th1/Th17 generation and suppress IFN-γ/IL-17 expression in other autoimmune disease models [10], whether their therapeutic potential for psoriasis remains unexplored and lacks direct evidence. Therefore, this study was designed to systematically evaluate, through rigorous animal experimentation, the therapeutic efficacy and underlying mechanisms of DPMF intervention in psoriasis.
Materials and methods
Experimental animals
Sixty-six male BALB/c mice (18–22 g, 6–8 weeks, SPF grade) were obtained from Liaoning Changsheng Biotechnology Co., Ltd. (license No. SCXK (Liao) 2020-0001) and housed at Inner Mongolia University for Nationalities Animal Center (23 ± 2 °C, 40–60% humidity, 12-h light/dark cycle).
Reagents and instruments
Imiquimod (IMQ) cream and calcipotriol ointment were obtained from Mingxin Pharmaceutical Co., Ltd. (Sichuan, China) and LEO Laboratories Limited (Dublin, Ireland), respectively. ELISA kits for IL-17, IL-22, and IL-23 were purchased from Boyan Biotechnology Co., Ltd.
(Nanjing, China). Reverse transcription and qPCR reagents were from Takara Bio Inc. (Shiga, Japan).
The dynamic permanent magnetic field (DPMF) was generated by a custom-built DPMF generator (Beijing Hengyuan Technology Co., Ltd., Beijing, China). The device comprises 6–8 arc-shaped NdFeB permanent magnets (grade N52; dimensions D62 × 153.4 mm) assembled into a ring using a Halbach array configuration; the magnet assembly has a radius of 60 cm. A brushless DC motor rotates the magnet assembly at 500 ± 3% rpm, producing a time-varying magnetic field at a frequency of 8 ± 3% Hz.
Peak magnetic field strength, measured with a tesla meter positioned at the center of the exposure plane, was 35–50 mT, and field uniformity across the 10 × 10 cm exposure area was ± 8%. These parameters were selected based on our prior optimization studies, which identified 50 mT as the minimal effective field strength for anti-inflammatory effects in murine models [unpublished preliminary data]. Additionally, 8 Hz falls within the extremely low-frequency range (3–30 Hz), which has been shown to modulate cellular calcium signaling and inflammatory responses [12].
Psoriasis induction and treatment
Following one-week acclimatization, mice were shaved (2 × 3 cm dorsal area) and randomized into seven groups using SPSS-generated random numbers: normal control(n = 8), IMQ model(n = 10), calcipotriol (Cal, n = 10), short-duration DPMF (SDPMF, 30 min, n = 10), long-duration DPMF (LDPMF, 60 min, n = 10), Cal plus SDPMF (n = 8), and Cal plus LDPMF (n = 10). Each mouse was identified by a unique ear tag. Except controls, all mice received 62.5 mg IMQ cream daily on the dorsal skin.
After six hours, interventions were administered: Cal groups received 100 mg topical calcipotriol (0.005%); DPMF groups, mice were placed in individual ventilated plastic restrainers (no anesthesia) with dorsal skin positioned 10 cm below the magnet assembly. Infrared thermometry confirmed that local tissue temperature increased by less than 0.3 °C during the 60-min exposure, verifying the non-thermal nature of the intervention. The 30-min and 60-min exposure durations were selected based on preliminary observations: exposures shorter than 20 min showed minimal clinical effect, whereas sessions longer than 90 min raise practical concerns for clinical translation; we acknowledge that these durations were chosen on pragmatic grounds rather than from a formal dose-escalation study.
Combination groups received both sequentially. On day 7, mice were euthanized under isoflurane anesthesia. Blood was collected via retro-orbital puncture, and dorsal skin was harvested, with half fixed in 4% paraformaldehyde for histology, half snap-frozen for molecular analysis.
Assessments and measurements
Daily photographs of the dorsal skin were taken, and Psoriasis Area and Severity Index (PASI) scores (erythema, scaling, induration; 0–4 scale) were blindly assessed by two independent investigators [13]. Epidermal thickness (stratum corneum to basal layer) and dermal inflammatory cell counts were quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA; RRID: SCR_003070) on H&E-stained sections. Serum cytokines (IL-17, IL-22, IL-23) were measured by ELISA.
Total RNA was extracted from snap-frozen skin samples using TRIzol reagent (Invitrogen, cat. no. 15596018), and RNA concentration and purity were assessed with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara Bio, Shiga, Japan; cat. no.
RR047A). Quantitative real-time PCR was performed using TB Green Premix Ex Taq II (Takara Bio; cat. no. RR420A) on a LightCycler 480 II system (Roche, Basel, Switzerland).
Skin mRNA expression of IL-23, IL-17 A, and IL-17 F was quantified by qRT-PCR using the 2^−ΔΔCt method with GAPDH as reference (primers in Table 1).
Table 1qRT-PCR primer sequencesGenePrimer Sequence (5’-3’)mGAPDHforward GACAGCCGCATCTTCTTGTGreverse AATCCGTTCACACCGACCTTmIL-23forward ATGCTGGATTGCAGAGCAGGTAreverse ACGGGGCACATTATTTTTAGTCTmIL-17 Aforward TTTAACTCCCTTGGCGCAAAAreverse CTTTCCCTCCGCATTGACACmIL-17 Fforward TGCTACTGTTGATGTTGGGACreverse AATGCCCTGGTTTTGGTTGAA
Statistical analysis
Normality was assessed using the Shapiro-Wilk test, and homogeneity of variance was verified using Levene’s test. PASI scores, which met normality assumptions, are presented as mean ± SD and were analyzed using repeated-measures ANOVA, followed by Bonferroni-corrected pairwise comparisons. Histological scores, serum cytokines, and qPCR data did not meet normality assumptions; these data are presented as median (P25, P75) and were analyzed using the Kruskal-Wallis test followed by Mann-Whitney U test for two-group comparisons.
P < 0.05 was considered statistically significant. All statistical analyses were conducted using SPSS 26.0 (IBM Corp., Armonk, NY, USA; RRID: SCR_002865) and GraphPad Prism 10.1.2 (GraphPad Software, San Diego, CA, USA; RRID: SCR_002798).
Results
Animal tolerance and mortality
Calcipotriol-treated groups exhibited notable treatment-related toxicity, manifesting as decreased appetite, lethargy, and weight loss from day 5 onward, with resultant mortality: Cal (1/10, day 6), Cal plus SDPMF (2/8, days 5 and 7), and Cal plus LDPMF (2/10, days 5 and 6) (Supplementary materials 1). Conversely, DPMF-only groups demonstrated excellent tolerance without adverse events.
Clinical Efficacy: PASI Scores
After excluding deceased individuals, a total of 62 mice were included in the final analysis (group-specific n values: Normal control n = 8; IMQ n = 10; Cal n = 9; SDPMF n = 10; LDPMF n = 10; Cal + SDPMF n = 6, one mouse completed the PASI assessment but died before tissue collection; Cal + LDPMF n = 8). The results showed that IMQ-induced lesions peaked at day 7 (PASI: 11.10 ± 0.99). All therapeutic interventions achieved significant improvement versus IMQ (all P < 0.0001; Figs.
1 and 2). DPMF exhibited a clear dose-duration effect: LDPMF (60 min) markedly outperformed SDPMF (30 min) (5.80 ± 0.79 vs. 8.10 ± 0.74, P < 0.001).
Calcipotriol monotherapy achieved intermediate efficacy (4.00 ± 0.71), while combination therapy yielded enhanced combined effects: Cal plus LDPMF produced the most profound PASI reduction (2.50 ± 0.76), significantly superior to Cal plus SDPMF (4.14 ± 0.38, P = 0.006) and all monotherapy groups (P < 0.001). Notably, no statistical difference existed between LDPMF and calcipotriol monotherapy (P = 1.000), suggesting comparable efficacy between interventions.
Fig. 1Representative clinical images of dorsal skin lesions across treatment groups on day 1–7. Ctr: normal control group; IMQ: imiquimod model group; IMQ + Cal: While modeling with imiquimod, topical calcipotriol is used; IMQ + SDPMF: short-duration DPMF (30 min); IMQ + LDPMF: long-duration DPMF (60 min); IMQ + Cal + SDPMF: While modeling with imiquimod, topical calcipotriol and SDPMF; IMQ + Cal + LDPMF: While modeling with imiquimod, topical calcipotriol and LDPMFThe image compares skin conditions over time (days 1, 3, 5, and 7) across seven treatment groups: control, IMQ, IMQ with Cal, IMQ with SDPMF, IMQ with LDPMF, IMQ with SDCPMF, and IMQ with LDCPMF.
It shows progressive changes in skin texture and appearance, with increasing roughness, scaling, and inflammation signs in IMQ-treated groups compared to control. Treatments combined with IMQ exhibit varying degrees of skin condition severity and recovery patterns over the days observed.
Fig. 2Temporal evolution of PASI scores (mean ± SD) during the 7-day intervention periodThe graphs compare six treatment groups over seven days on four measures: redness, scale, thickness, and PASI score. The normal control group remains at zero across all measures and days.
The imiquimod model group shows a steady increase in all measures, peaking around day 6 or 7. The group treated with imiquimod plus topical calcipotriol shows a sharper increase, peaking earlier around day 5 or 6, then declining by day 7. Groups with short-duration or long-duration DPMF treatments, alone or combined with calcipotriol, generally show intermediate increases that peak between days 5 and 6, followed by declines or stabilization by day 7.
Overall, the data illustrate differences in the progression and peak severity of skin lesion measures across treatment groups over time.
Histopathological Improvements
Three mice per group (n = 21 total) were selected for histopathological examination using stratified random sampling based on day 7 PASI scores to ensure representation across disease severity spectrum. H&E staining revealed that IMQ-induced dramatic epidermal hyperplasia and massive inflammatory cell infiltration (Fig. 3).
All interventions significantly reversed these pathological features versus IMQ (P < 0.0001 for epidermal thickness and cell counts). The Cal plus LDPMF group demonstrated near-normal skin architecture with minimal epidermal thickness 14.60(13.78, 15.13) µm and lowest inflammatory cell counts 78.0(68.0, 81.0) cells/HPF. Critically, SDPMF monotherapy yielded comparable histological improvement to calcipotriol alone (thickness: 24.73(24.45, 25.14) vs.
25.43(24.85, 26.29) µm, P = 1.000), validating its standalone therapeutic potential.
Fig. 3H&E-stained skin sections (×200 magnification) showing epidermal hyperplasia and inflammatory infiltrationThe image presents microscopic views of mouse skin tissue under seven different treatment conditions labeled A through G, showing variations in epidermal thickness and inflammatory cell presence. Panels A through G display histological sections stained to reveal skin structure and cellular details.
Panel H quantifies mouse epidermal thickness, showing the highest thickness in the IMQ group, reduced thickness in groups treated with Cal, SDPMF, LDPMF, and their combinations, and the lowest thickness in the control group. Panel I quantifies inflammatory cell counts, with the IMQ group having the highest count, reduced counts in treated groups, and the lowest in the control group. Statistical markers indicate significant differences between groups.
Molecular Correlates: Cytokine and mRNA Expression
Due to difficulties in blood collection caused by mouse deaths or weight loss in the later stages of the experiment, four serum samples were finally collected from each group. Serum analyses demonstrated IMQ-induced marked elevation of IL-17, IL-22, and IL-23 (n = 4/group). All treatments significantly suppressed these cytokines (P < 0.05 vs.
IMQ), with Cal plus LDPMF achieving the most pronounced reduction (IL-17: 0.23(0.22,0.42) pg/ml; IL-22: 8.43(7.95,8.77) pg/ml; IL-23: 12.40(12.36,12.56) pg/ml; Table 2).
Table 2Expression levels of inflammatory cytokines IL-17, IL-22, and IL-23 in mouse serum (Pg/ml)GroupIL-17IL-22IL-23Normal control1.52(1.33,1.73)5.85(5.60,6.19)10.98(10.10,11.65)IMQ model6.04(5.77,6.19)#11.88(11.72,12.18)#16.92(15.94,17.73)#Calcipotriol2.77(2.34,3.24)*7.63(7.50,7.84)*13.66(13.43,13.90)*SDPMF (30 min)1.61(1.59,1.79)*9.00(8.89,9.36)*14.17(13.93,14.32)*LDPMF (60 min)1.05(0.97,1.08)*7.90(7.74,8.17)*13.12(12.89,13.39)*Cal + SDPMF2.01(1.67,2.40)*11.29(11.18,11.37)12.97(12.90,13.08)*Cal + LDPMF0.23(0.22,0.42)*8.43(7.95,8.77)*12.40(12.36,12.56)*#P<0.05 vs. Normal control; *P<0.05 vs. IMQ model (Mann-Whitney U test).
Data are presented as median (P25, P75)
Tissue mRNA expression (n = 3/group) revealed IMQ upregulated IL-17 A, IL-17 F, and IL-23 by 9-, 100-, and 33-fold, respectively. All interventions significantly downregulated these transcripts. Crucially, the LDPMF monotherapy group and the Cal plus LDPMF exhibited the greatest reduction, approaching the normal group level (Fig.
4).
Fig. 4Relative mRNA expression levels of IL-23, IL-17 A, and IL-17 F in skin lesions (normalized to GAPDH)The figure presents three bar graphs comparing relative mRNA levels of IL-17A, IL-17F, and IL-23 across seven experimental groups: control, IMQ, IMQ plus calcipotriol, IMQ plus SDPMF, IMQ plus DPMF, IMQ plus calcipotriol and SDPMF, and IMQ plus calcipotriol and DPMF. In all three graphs, the IMQ group shows a marked increase in mRNA levels compared to control.
The groups treated with calcipotriol, SDPMF, DPMF, or their combinations alongside IMQ exhibit reduced mRNA levels relative to IMQ alone. Statistical markers indicate significant differences between the IMQ group and other groups, highlighting the effect of treatments in lowering mRNA expression induced by IMQ.
Discussion
This study exploratorily compared DPMF intervention with topical calcipotriol in an IMQ-induced psoriasis mouse model. Our findings indicate that DPMF exposure duration correlates with therapeutic benefit, and that combining DPMF with calcipotriol yields additive effects exceeding either monotherapy. These observations suggest that DPMF may complement existing topical agents through distinct mechanistic pathways, warranting further investigation of optimized combination protocols.
The IL-23/IL-17 axis represents a well-established driver of psoriasis pathogenesis. IL-23 promotes Th17 differentiation and subsequent IL-17 A/IL-17 F release, which perpetuate keratinocyte hyperproliferation and neutrophilic inflammation [14–18]. In this small-sample animal model study, DPMF exposure was associated with reduced serum IL-17, IL-22, and IL-23 levels, alongside decreased lesional expression of IL-17 A, IL-17 F, and IL-23 mRNA.
Notably, the magnitude of cytokine suppression corresponded to DPMF duration, with LDPMF achieving reductions comparable to or exceeding calcipotriol monotherapy. These associations are consistent with prior demonstrations that magnetic fields can modulate Th1/Th17 polarization and inflammatory cytokine production in autoimmune disease models [10], though direct mechanistic evidence in psoriasis remains lacking. Whether DPMF exerts these effects through direct immune cell interaction, keratinocyte-mediated feedback, or systemic anti-inflammatory modulation requires dedicated investigation—potentially through in vitro studies of DPMF-exposed Th17 cells or dendritic cell cultures.
In addition to immunomodulation, magnetic therapy may enhance tissue repair through multiple physiological pathways. Several studies demonstrate that magnetic and electrical stimulation increase collagen deposition, ion transport, amino acid uptake, fibroblast migration, and ATP/protein synthesis, thereby promoting cell division, differentiation, and wound healing [7, 19, 20]. While resource constraints prevented us from measuring these regenerative markers directly in psoriatic lesions, we acknowledge that DPMF’s beneficial effects may partially stem from these fundamental biophysical actions.
Future studies incorporating detailed analyses of tissue repair mechanisms will be essential to fully elucidate DPMF’s therapeutic repertoire.
A salient advantage of DPMF is its non-thermal, non-invasive nature, achieving significant lesional improvement within just 7 days without the risks of hyperpigmentation, photoaging, or cataractogenesis associated with conventional phototherapy [21]. Moreover, psoriasis demonstrates strong associations with metabolic comorbidities including obesity, diabetes, and hypertension [22]. Accumulating evidence shows magnetic therapy significantly benefits metabolic disorders such as diabetes and cardiovascular disease [23–25], making DPMF maybe suitable for psoriatic patients with metabolic syndrome or photosensitivity, though this remains speculative.
Regarding safety, in contrast to the findings reported by Zhang et al., who observed no toxicity with 200 mg/day calcipotriol administered for 7 consecutive days [26], the calcipotriol-treated groups in this study exhibited notable toxicity, which sharply contrasted with the favorable tolerability of DPMF. We speculate that the underlying reasons may be as follows: a daily topical dose of 100 mg calcipotriol ointment represents a substantial volume for a 20 g mouse, and inadequate consideration of rodent grooming behavior likely contributed to systemic exposure, resulting in lethargy, weight reduction, and death in both monotherapy and combination groups. This highlights insufficient attention to formulation volume and behavioral control when translating human topical administration protocols to small-animal models.
Additionally, magnetic field stimulation may increase local cutaneous blood flow and permeability, thereby enhancing calcipotriol absorption. Future studies could further optimize calcipotriol dosing regimens in murine models by reducing single-application volume, employing Elizabethan collars to prevent grooming, and incorporating more frequent behavioral observation and body weight monitoring endpoints. The absence of serial calcium measurements precludes definitive diagnosis of vitamin D intoxication.
Future studies must incorporate hypercalcemia screening to clarify toxicity mechanisms.
Meanwhile, due to limited experimental resources, this study has the following limitations. First, the primary limitation was the lack of sample size calculation prior to the study, and the final sample size for molecular analyses was small (n = 3–4/group) due to unexpected calcipotriol-related mortality. This substantially reduces statistical power and renders cytokine and gene-expression findings exploratory rather than definitive, requiring validation in adequately powered studies.
Second, the observed downregulation of IL-23 and IL-17 A cannot distinguish between a direct effect of DPMF on pathogenic T cell subsets (e.g., Th17 cells) and indirect anti-inflammatory effects mediated via keratinocyte regulation or systemic feedback loops. Therefore, the association between DPMF and IL-23/IL-17 axis modulation requires further investigation. In future studies, we aim to explore the specific molecular mechanisms by assessing cytokine production in Th17 cell cultures or bone marrow-derived dendritic cells exposed to DPMF.
Third, our exposure gradient was insufficient—we lacked 2-hour or 3-hour daily groups to fully characterize the exposure-response curve, and we also lacked a sham magnetic-field control group, which prevents the exclusion of placebo effects, handling stress, or environmental factors. Fourth, initial group sizes were uneven, though we maintained rigorous experimental standards and transparent data reporting. Finally, a critical design limitation is the simultaneous initiation of IMQ application and intervention on day 1, which precludes distinguishing prophylactic (preventing lesion development) from therapeutic (reversing established lesions) effects.
This substantially limits translational interpretation, as clinical psoriasis treatment is administered to existing lesions. Future studies must employ established-lesion protocols (IMQ induction followed by delayed intervention initiation) to determine true therapeutic efficacy.
In summary, DPMF shows promising initial effectiveness in reducing psoriatic lesions, with a favorable short-term safety profile. It may also offer additional benefits when used in combination with existing topical treatments. These findings highlight the need for further research through well-powered, sham-controlled studies that use established lesion protocols.
Such studies will help clarify therapeutic mechanisms, optimize dosing, and assess long-term safety—key steps before considering clinical translation for patients with refractory or metabolically complicated psoriasis.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1
Supplementary Material 2